Subtribal and Generic Relationships of Maxillarieae (Orchidaceae) with Emphasis on Stanhopeinae: Combined Molecular Evidence

by W. Mark Whitten, Norris H. Williams, Mark W. Chase
Citation
Title:
Subtribal and Generic Relationships of Maxillarieae (Orchidaceae) with Emphasis on Stanhopeinae: Combined Molecular Evidence
Author:
W. Mark Whitten, Norris H. Williams, Mark W. Chase
Year: 
2000
Publication: 
American Journal of Botany
Volume: 
87
Issue: 
12
Start Page: 
1842
End Page: 
1856
Publisher: 
Language: 
English
URL: 
Select license: 
Select License
DOI: 
PMID: 
ISSN: 
Abstract:

SUBTRIBAL

AND GENERIC RELATIONSHIPS OF MAXILLARIEAE WITH EMPHASIS ON

(ORCHIDACEAE) STANHOPEINAE:

COMBINED MOLECULAR EVIDENCE'

W. MARKWHIT TEN,'.^ NORRISH. WILLIAMS,^ AND MARKW. CHASE^

2Florida Museum of Natural History, University of Florida, Gainesville, Florida 32611-7800 USA; and ?Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3DS, UK

The monophyly of and phylogenetic relationships within the orchid tribe Maxillarieae Pfitzer were evaluated using parsimony analyses of combined nuclear ribosomal and plastid DNA sequence data of ITS 1 and 2, matK, and the trnL intron and the tmL-F intergene spacer. Each of the separate analyses produced highly congruent but weakly supported patterns (by the bootstrap), so these were combined in a single analysis. Analysis of 90 ingroup taxa (representing -35% of currently recognized genera) and four outgroup taxa produced resolved and highly supported cladograms. Based on the cladograms, we recognize six subtribes: Eriopsidinae, Onci- diinae (including Pachyphyllinae, Omithocephalinae, and Telipogoninae), Stanhopeinae, Coeliopsidinae, Maxillariinae (including Ly- castinae and Bifrenariinae), and Zygopetalinae (including Cryptarrheninae, Dichaeinae, Huntleyinae, and Warreinae). Stanhopeinae were sampled most intensively; their generic relationships were highly resolved in the analysis and largely agree with currently accepted generic concepts based on morphology. Coeliopsidinae (Coeliopsis, Lycomormium, Peristericz) are sister to Stanhopeinae. Correlations are drawn among phylogeny, pollination mechanisms, and life history traits.

Key words: Coeliopsidinae; ITS; matK; Maxillarieae; Maxillariinae; Orchidaceae; Stanhopeinae; tn1L-F.

Tribe Maxillarieae Pfitzer sensu Dressler (1993) consist of -2600 species in -165 genera (-10% of Orchidaceae) and contain many of the showy epiphytic orchids of the Neotropics including horticulturally important genera such as Lycaste Lindl., Oncidium Sw., Odontoglossum Kunth, Stanhopea Frost ex Hook., and Zygopetalum Lindl. The tribe includes most Neotropical orchids possessing a complex pollinarium with a viscidium and stipe, pseudobulbs usually of a single internode, and the Maxillaria seed type (Barthlott and Ziegler, 1981; Chase and Pippin, 1987). They have highly diverse vegetative habits, floral morphology, and pollination mechanisms. Within Maxillarieae, subtribe Stanhopeinae contain some of the most exotic pollination mechanisms found in orchids (Darwin, 1877; van der Pijl and Dodson, 1966). They are pollinated exclusively by male euglossine bees collecting fragrant chem- icals from the flowers, and their complex floral shapes manip- ulate the bees to place pollinaria on precise locations on the bee's body. We now know a considerable amount about the pollination biology of Stanhopeinae from the fieldwork of Dodson, Dressler, and others, but understanding the evolution of pollination-related traits requires a reliable phylogeny.

In this study, we present analyses of Maxillarieae based on combined analyses of nuclear and plastid regions. Early in the course of our analyses of Stanhopeinae, we concluded that the choice of outgroups was problematic because an explicitly

' Manuscript received 30 September 1999; revision accepted 2 March 2000.

The authors thank Giinter Gerlach (Botanischer Garten Miinchen-Nym- phenburg), Rudolf Jenny, Ron Determann (Atlanta Botanical Garden), John Atwood (Marie Selby Botanical Gardens), Rodrigo Escobar, Roberto Vasquez, Calaway Dodson, Gustavo Romero (AMES), German Carnevali, and espe- cially Robert Dressler for plant specimens and valuable discussions, Wendy Zomlefer and Walter Judd for helpful suggestions on the manuscript, and Antony Cox and Anette de Biuijn (Royal Botanic Gardens, Kew) and Savita Shankar and Ernesto Almira (ICBR, Univ. of Florida) for valuable help in the lab. The Ecuadorian Ministerio de Agricultura y Ganaderia generously provided permits and assistance in field work. This work was supported by NSF grant DEB 9509071 to WMW and grant DEB 9815821 to NHW and by grants from the American Orchid Societv Fund for Education and Research.

Author for reprint requests (e-mail: whitten@FLMNH.UFL.EDU).

phylogenetic classification of the tribe Maxillarieae was lack- ing. Consequently, we broadened our analysis to include rep- resentatives of all major groups within the tribe confirmed by the broad rbcL analyses of Cameron et al. (1999). This paper examines subtribal circumscription within Maxillarieae with emphasis on generic relationships within Stanhopeinae. Sub- sequent papers will focus on the individual subtribes and char- acter evolution in greater detail.

Few modern workers have produced classifications of Max- illarieae that attempt to recognize phylogenetic relationships. Those of Schlechter (1926), Dressler and Dodson (1960), and Garay (1972) were clearly artificial. Dressler (1981) originally placed Stanhopeinae in Cymbidieae (among subtribes such as Catasetinae, Cyrtopodiinae, and Oncidiinae) based on the oc- currence of two pollinia; those subtribes with four pollinia were placed in Maxillarieae. Chase (1987) and Dressler (1989) hypothesized that Vandeae (sensu lato) are a polyphyletic grade and that reduction in pollinium number occurred repeatedly. Dressler (1993) placed Stanhopeinae in Maxillarieae together with subtribes such as the Zygopetalinae and Lycas- tinae, reflecting a change of opinion about the importance of pollinium number and increased emphasis on vegetative char- acters such as the number of nodes in the pseudobulbs. By contrast, Burns-Balogh and Funk (1986) separated Maxillar- ieae and Vandeae solely on the basis of pollinium fusion; they included Stanhopeinae in their broad Vandeae together with such taxa as Sarcanthinae, Catasetinae, and Oncidiinae (all with two pollinia). In their classification, Maxillarieae are foot- noted as being "not monophyletic" (presumably polyphylet- ic).

None of the most recent classifications of Maxillarieae (Dressler, 1993; Brieger, Maatsch, and Senghas, 1994-2000; Szlachetko, 1995) are explicitly cladistic, but all provide mod- ern hypotheses of relationships. The three classifications dis- agree on circumscriptions within the tribe; Dressler favors a broad Maxillarieae with eight subtribes, whereas Szlachetko splits these same taxa among seven tribes and 26 subtribes,

1842

and Brieger splits them into three tribes and at least 19 sub- tribes. In spite of different ranking criteria, these classifications are largely congruent on the delimitation and composition of many taxa. They disagree on the placement of several anom- alous genera, such as Eriopsis, Dichaea, Vargasiella, Scuti- curia, and Cryptarrhena. The classifications differ most in their treatment of oncidioid orchids; Dressler recognized a broad Oncidiinae, whereas Brieger and Szlachetko divided these taxa among numerous subtribes. The composition of on- cidioid clades also varied greatly among systems. Giinter Ger- lach recently prepared the treatment of Stanhopeinae and Coe- liopsidinae for the Brieger, Maatsch, and Senghas classification (Brieger, Maatsch, and Senghas, 2000); his treatment incor- porated the molecular evidence from our study.

Freudenstein and Rasmussen (1999) produced a more rig- orous morphology-based cladistic analysis of Orchidaceae, but the resulting cladograms yield little resolution at the subtribal level. Recent molecular studies at the family (Cameron et al., 1999) and lower levels (Cox et al., 1997; Douzery et al., 1999; Kores et al., 1997) are helping to define higher level relation- ships within the orchids, but none of these sampled extensively within Maxillarieae. The Cameron et al. (1999) rbcL analysis of Orchidaceae included 20 representatives of Maxillarieae (sensu Dressler, 1993), which form a monophyletic clade sister to Catasetinae and Cyrtopodiinae in the shortest trees, although without high bootstrap support.

We attempted to clarify these generic and subtribal relation- ships by performing parsimony analyses of sequence data from three regions: matK (plastid), trnL intron and trnL-F spacer (hereafter treated as a single matrix designated trnL-F; plastid), and ITS 1, 5.8S, and ITS 2 (nuclear ribosomal DNA; hereafter referred to as ITS nrDNA). The matK gene codes for a maturase that is -1550 bp in length and several times more variable than rbcL in most angiosperms (Soltis and Soltis, 1998). The trnL-F region (Taberlet et al., 1991) is largely non- coding and consists of an intron in the trnL (UAA) gene and the trnL-trnF (GAA) intergene spacer. The widely used ITS nrDNA region (Baldwin et al., 1995) consists of two noncod- ing spacer regions flanking the 5.8s gene. Many recent studies have indicated that combined molecular data sets using regions with different levels of variation provide resolution at different areas of the cladogram, and phylogenetic resolution and levels of support are improved by directly combining independent molecular data sets (Chase and Cox, 1998; Soltis et al., 1998).

MATERIALS AND METHODS

Plarzt material-Table 1 is a list of species examined and voucher infor- mation. Taxa within Stanhopeinae were chosen to represent all genera and representative variation within larger genera, morphologically uniform genera (e.g., Paphinia) are represented by a single taxon, whereas larger, more var- iable genera are represented by several species from different sections or groups (e.g., Gongora, Stanhopen). Choice of outgroups was based on results of rbcL (Cameron et al., 1999) and tnatK analyses (Freudenstein, Kores, Gold- man, Chase, and Whitten, unpublished data). We included Dressleria (Cata- setinae), Elilophia (Eulophiinae), and Cyrtopodium and Granzmatophyllun2 (Cyrtopodiinae) as outgroups based on the results of these broader analyses

Molecular techniques-DNA was extracted from either fresh or silica gel- dried material (Chase and Hills, 1991) according to the methods of Doyle and Doyle (1987), scaled down to 1.0-mL extraction volumes. DNA was precip- itated overnight at -20°C with 0.65 volumes of isopropanol, centrifuged, washed twice with 70% ethanol, and dried. The pellet was resuspended in 75

p.L of Tris-EDTA buffer (TE) and stored at -20°C. Amplification of DNA was generally performed using 50-p.L reactions with 35 cycles, 2.5 mmol/L MgCl,, and a hot start, using Promega (Promega Corp., Madison, Wisconsin, USA) or Epicentre (Epicentre Technologies, Madison, Wisconsin, USA) buff- ers and Taq polymerase. Annealing temperatures for amplification were 51°C for matK and 55-58°C for trnL-F. For ITS, a touchdown thermal cycling program was used; the initial annealing temperature was 76°C decreasing 1°C per cycle for 15 cycles, followed by 15 cycles at 61°C. DNA samples that failed to amplify were cleaned to remove inhibitors using QIAquick columns (Qiagen, Inc., Santa Clarita, California, USA). Some samples that failed to amplify for ITS using standard conditions were amplified successfully by adding betaine (1.0 molL final conc.) to the PCR (polymerase chain reaction) mix. Amplification and sequencing primers were those of Sun et al. (1994) for ITS 1 and 2 and Taberlet et al. (1991) for tmL-F. Some amplifications for trnL-F using primers c and f produced multiple bands; for these taxa, the region was amplified in two separate reactions using primers c and d and e and f, which yielded single products. Primers used for tnatK are (5' to 3'; locations approximate): 56F-ACTTCCTCTATCCGCTACTCCTT; 749FTTGAGCGAACACATTTTTCTATGGAA; 832R-ACATAATGTATGAAAGTATMTTTGA; 1520R-CGGATAATGTCCAAATACCAAATA. Some taxa were amplified using the matK primers trnK-3914F and trnK-2R of Johnson and Soltis (1995) and then sequenced using the above primers.

PCR products were purified using Wizard PCR Preps system (Promega, Inc., Madison, Wisconsin, USA) or QIAquick columns (Qiagen, Inc., Santa Clarita, California, USA) and directly sequenced on an PE Biosystems, Inc. (ABI; Foster City, California) 373 or 377 automated sequencer using standard dye-terminator chemistry according to manufacturer's protocols, except that cycle sequencing reactions were scaled down to 5 p.L. Both strands were sequenced to assure accuracy in base calling. The ABI software packages "Sequence Nav~gatoP" and autoa assemble^^" were used to edit and as- semble complementary and overlapping sequences, and each individual base position was examined for agreement of the two strands. DNA sequences were aligned manually, and gaps were coded as missing values. The ends of ma- trices were trimmed to exclude sequencing artifacts. One region of ambiguous alignment was excluded in the ITS nrDNA matrix, and five regions (totaling 149 bp) were excluded from the trnL-F matrix. Sequences are deposited in GenBank (matK AF239415-AF2395 10; tmL-F AF2395 11-AF239606; ITS AF239319-AF239510). The aligned data matrix is available from the authors and is archived at http://www.botany.orgibsa/ajbsupp/v87/whitten.html . All cladistic analyses were performed using PAUP'+ersion 4.0b2 (Swofford, 1999). MacClade version 3.08a (Maddison and Maddison, 1997) was used to plot the number of steps per site.

Search strategies-Each matrix (three separate and the combined ITS nrDNAitrnL-FilnatK) was subjected to 1000 replicates of random taxon entry additions, MULTREES on, using subtree pruning and regrafting (SPR) swap- ping, but saving only ten trees per replicate to minimize time spent swapping on suboptimal islands. The shottest trees from this search were used as stating trees and up to 10000 trees were swapped to completion using SPR; the tree limit was set to 10000 for each matrix due to computer memory limitations. For the combined analysis, up to 10000 Fitch trees were used as starting trees for successive weighting (SW; Fanis, 1969). SW was used to downweight sites that are highly homoplasious. Lledd et al. (1998) provided a lucid dis- cussion of this successive weighting strategy. The characters were reweighted on the rescaled consistency index (RC) based on the best performance on trees using the menu command in PAUP*. Each round of analysis consisted of ten replicates of random taxon entry, MULTREES on, SPR swapping, and holding ten trees per replicate. The shortest trees collected in each of these ten replicates were used as starting trees to collect all shortest SW trees, which were swapped to completion. Rounds of search followed by reweighting were repeated until tree length remained the same in two successive rounds. Trees were evaluated on the basis of tree length, consistency index (CI), and reten- tion index (RI) as calculated in PAUP:" Confidence limits for trees were assessed by performing 1000 replicates of bootstrapping (Felsenstein, 1985) using equal weighting, SPR swapping, MULTREES on, and holding only ten trees per replicate. For the combined analysis, bootstrapping was performed

TABLE1. List of taxa examined and voucher specimens.

Taxon

Acineta superbn (Kunth) Rchb.f. Ada altrantinca Lindl. Anguloa hohenlohii C. Morren AnguIoa unijorn Ruiz & Pav. Bateinannin colleyi Bateman ex Lindl. Bifrenaria atropurpurea (Lodd.) Lindl. Bifrenaria inodorn Lindl. Bifrenaria tetrngona (Lindl.) Schltr. Braentia vittatn (Lindl.) Jenny Brassia arcuigera Rchb.f. Brnssin gireoudinnn Rchb.f. & Warsz. Chnubardia lzeteroclita (C. Schweinf.) Dodson & D.E. Benn. Chondrorhynclza reiclzenbachiana Schltr. Cirrhaea dependens (Lodd.) Rchb.f. Cisclz>veinjia dasyandrn (Rchb.f.) Dressler & N.H. Williams Coeliopsis lzyacinthosma Rchb.f. Coryanthes elegantiltm Linden & Rchb.f. Coryanthes macrantha (Hook.) Hook. Cryptarrhena lltnata R.Br. Crytocentrunz calcaratctm (Schltr.) Schltr. Cuitlauzina pendula La Llave & Lex. Cyrtochilum nrtnulare (Rchb.f.) Kraenzl. Cyr-topodi~tmpurtctntur7z (L.) Lindl. Dichaea muricata (Sw.) Lindl. Dichnea neglectn Schltr. Dressleria dilecta (Rchb.f.) Dodson Embreea rodignsinnn (Claes ex Cogn.) Dodson Eriopsis rutirlobulbon Hook. Eriopsis rlttidobulbon Hook. Euloplzia guineeizsis Lindl. Ferr~aizdezia ionantlzern (Rchb.f. & Warsz.) Schltr. Gongorn ampnroana Schltr. Gongora armeninca (Lindl. & Paxton) Rchb.f. Gongorn escobnrinnn Whitten Gongora gnleata (Lindl.) Rchb.f. Gongora gratulabunda Rchb.f. Gongorn ilense Whitten & Jenny Gorzgora portentosn Linden & Rchb.f. Gongorn splzaericn Jenny Gongora trirlentata Whitten Grammatopltyllurn speciosum Blume Horichia dressleri Jenny Hosllletia sanderi Rolfe Houlletia tigrina Linden ex Lindl. Houlletin wnllisii Linden & Rchb.f. Kegeliella atropilosa L.O. Williams & Heller Kegelielln kupperi Mansf. Koellensteir2ir1 altissima Pabst Lacaenn spectabilis Rchb.f. Lockhartin oerstedii Rchb.f. Lueddenzannin pescntorei (Lindl.) Linden & Rchb.f. Lycaste crltentn Lindl. Lycomormiuin jiskei Sweet Maxillarin umbratilis L.O. Williams Maxillarin violaceopurtctata Rchb.f. Mesospiizidiuin pananteizse Garay Miltonia regnellii Rchb.f. Neomoorea wallisii (Rchb.f.) Schltr. Oncidiunz amplintum Lindl. Oncidium cebolleta (Jacq.) Sw. Oncidiunz ornithorrlzynch~tm Kunth Ornithocephalus injexus Lindl. Paplziizin neudeckeri Jenny Pescatoren lelzmanizii Rchb.f. Peristeria elnta Hook. Peristeria lindenii Rolfe Polycycnis aurita Dressler Polycycnis ornata Garay Polycycnis gratiosa Endres & Rchb.f. Psychopsis pnpilio (Lindl.) H.G. Jones

Collector

Whitten 90226 Chase 86007 Whitten 94083 Whitten 903 11 Chase 84746 Whitten s.n. Whitten 93 197 Whitten 93 156 Chase 84748 Whitten 91272 Williams s.n. Whitten 88023 Whitten F1295 Whitten 93 152

H. Hills 861 15 Whitten 93 153 Whitten 87268 Whitten 9501 8 Whitten 98000 Whitten s.n. Whitten s.n. Whitten 91062 Chase 0-126 Chase 0-93 Higgins 1021 Whitten F1046 Whitten 90105 Whitten 91 136 Whitten s.n. Whitten s.n. Whitten 97069 Whitten 901 36 Whitten F1636 Whitten 95023 Salazar 2835 Whitten 91394 Whitten 87 188

D.E. Bennett, Jr. Whitten s.n. Embree 3 Chase 89103 Whitten 93151 Whitten 93079 Whitten 9 1354 Whitten 88021 Whitten 93 101 Whitten F167 Chase 90004 Whitten F184 Chase 83243 Jenny s.n. Whitten 97021 Whitten 91 340 SEL 1995-0397 SEL 1981-2139 Whitten F195 Whitten 92014 Whitten 90010 Chase 84104 Whitten 9607 1 Whitten s.n. Dressler s.n. Whitten 88041 Whitten 93041 Whitten 90158 Whitten 88187 Whitten 87280 Whitten 91 11 1 Whitten 93178 Whitten s.n.

Voucher location

FLAS

K

FLAS

FLAS

K

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

K

K

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

K

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

K

FLAS

FLAS

SEL

SEL

FLAS

FLAS

FLAS

K

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

FLAS

TABLE1. Continued

-.

Taxon

Rudoljielln snxicola (Schltr.) C. Schwienf. Schlirnmin sp. Schlimmin stevensonii Dodson Scuticnria hadwenii (Lindl.) Hook. Sievekingia colombinnn Garay Sievekingia lzerrenhusann Jenny Sorerosnnrhus shepheardii (Rolfe) Jenny Sranhopea nrzfrncta Rolfe Sfanhopea annulafn Mansf. Stanlzopea cirrlzata Lindl. Stnnhopen ecornutn Lem. Stanhopen pulla Rchb.f. Starzhopen ruckeri Lindl. Stanhopen saccatn Bateman Starzlzopea tigrina Bateman ex Lindl. Starzlzopea bvarrlii Bateman ex Lindl. Srellilabium pogonostalix (Rchb.f.) Garay & Dunst. Telipogorz pan~ulus C. Schweinf. Trevorin zalzlbruckrzeriann (Schltr.) Garay Trichocentrum pfavii Rchb.f. Triclzopilia nzaculuta Rchb.f. Trigoniiiium egertonianum Bateman ex Lindl. Vasqueziella boliviarza Dodson Warrea war-reana (Lodd. ex Lindl.) C. Schweinf. Xylobium leontoglossunz (Rchb.f.) Rolfe Xylobiztrn pnllid(jlorurn (Hook.) G. Nicholson Xylobium zarurnense Dodson Zygopetnlum mackayi Hook.

using equal weights and also using the final weight set from successive weighting.

Patterns of sequence evolution were estimated using MacClade (Maddison and Maddison, 1997) with matrices stripped to include only the positions included in the cladistic analyses. Because we believe that the trees from the combined (SW) analyses are the most accurate estimates of phylogeny (due to higher overall bootstrap support), we assessed the evolution of each region on one of these trees, rather than trees produced from analyses of separate data sets. To calculate the number of transitions and transversions [and their consistency indices (CI) and retention indices (RI)] observed on one of the shortest SW trees, we used a stepmatrix to calculate the number of transvep sions at each base position by weighting the transitions to zero. After invoking the "Typesets" command in PAUP" and loading one of the shortest SW trees, the "Tree score" command was used to calculate the number of transversions and their collective CI and RI (ACCTRAN optimization). From these, we calculated those of transitions.

We assessed congruence of the separate data sets by visual inspection of the individual bootstrap consensus trees. We considered the bootstrap trees to be incongruent only if they displayed "hard" (i.e., highly bootstrap supported) incongruence, rather than "soft" (poorly bootstrap supported) incongruence (Seelanan, Schnabel, and Wendel, 1997; Wiens, 1998). We use the following descriptions for categories of bootstrap support: unsupported, 40%; weak, 50-74%; moderate, 75-84%; strong 85-100%. We consider percentages 40% to be unsupported because such groups often are not present in all shortest Fitch trees. All trees illustrated with branch lengths include autapo- morphies; CIS reported also include autapomorphies (even without autapo- morphies the CI is a less meaningful statistic and so we emphasize RI as the more meaningful measure of performance; see Davis et al., 1998, for a dis- cussion of the problem of using even a standard calculation of CI).

RESULTS

For each separate and combined analysis, Table 2 presents the number of included aligned positions in the matrix, the number of variable sites, the number of phylogenetically in- formative sites, and the percentage of sites that are variable. For each portion (Fitch and/or successively weighted) of each analysis, we report the number of trees, number of steps, con- sistency index (CI), retention index (RI), and the average num- ber of changes per variable site (tree length divided by the number of variable sites). Table 3 presents number of steps, CI, and RI for transitions and transversions for each codon position in nzatK. Table 4 presents the number of steps, CI, and RI for transitions and transversions for each region.

Collector    Voucher locatioll
Whitten 97020    FLAS
Whitten 88220    FLAS
Whitten 94107    FLAS
Whitten 97019    FLAS
Gerlach 295    HEID
Whitten 93010    FLAS
C.H. Dodson 18580-3    FLAS
Whitten 87228    FLAS
Whitten F1514    FLAS
Whitten F1296    FLAS
Whitten 90026    FLAS
Whitten 931 17    FLAS
Whitten 94006    FLAS
Whitten F1004    FLAS
Whitten F1545    FLAS
Whitten F1024    FLAS
Chase 0-123    K
Dressler s.n.    FLAS
Dodson 17309    QCNE
Whitten s.n.    FLAS
Whitten s.n.    FLAS
Whitten 93099    FLAS
R. Vasquez s.n.    FLAS
Chase 87050    FLAS
Whitten 91384    FLAS
Whitten 90241    FLAS
Whitten 89096    FLAS
Whitten 90176    FLAS
matK-The aligned matK matrix consists of 1379 included bases, of which 485 (35%) were variable and 260 (19%) were potentially informative. The matrix contains five indels (rang- ing in length from 3 to 9 base pairs), of which four are auta- pomorphic. Substitutions in nzatK are relatively even (Fig. I), although they increase slightly between positions 600 and 900. The transition/transversion (tsltv) ratio is 0.61, lower than the ratios found in dicots (Johnson and Soltis, 1995; Xiang, Soltis, and Soltis, 1998). Third-codon positions contributed the most steps (38.8% based on the combined tree), slightly more steps than first (32.2%) or second (28.5%) positions, but all three sites displayed approximately equal CI and RI values (Table 3). Transitions were less numerous and had both a higher CI and RI than transversions (Table 4). Heuristic search (Fitch criterion) yielded more than 10 000 equally parsimonious trees of 1140 steps (CI 0.56, RI 0.69).

The Fitch bootstrap consensus (Fig. 2) is marked by a large polytomy. The consensus shows weak support for a broad On- cidiinae, including Pachyphyllinae, Telipogoninae, and Omith- ocephalinae; "core" Oncidiinae (Miltonia to Mesospinidium) receive moderate support. Zygopetalinae including Cvptar- rhena and Dichaea are also strongly supported. A broad Max- illariinae are unsupported, but several clades within it [Max-

weighted (SW) lengths; those in parentheses are Fitch lengths.

mntK

No. included positions in matrix No, variable sites No. phylogenetically informative sites No. of trees (Fitch) No. of steps

RI Ave. no. of changes per variable site

(no. stepslno. var. sites) No. of trees (SW) No. of steps* CI (SW) RI (SW) Length on SW combined tree No. of missed steps (SW) No. of clades in bootstrap consensus with

>85% support

illariinae (sensu stricto), Lycastinae, Bifrenariinae, Xylobium] are moderately to strongly supported. Stanhopeinae sensu Dressler (1993) are unsupported and divided into a Coeliopsisl LycomormiumlPeristeria clade (Coeliopsidinae), Braemia, and a moderately supported remainder, hereafter referred to as core Stanhopeinae. Many clades within core Stanhopeinae are high- ly supported. The position of Eriopsis is unresolved within Maxillarieae in the strict consensus of all shortest trees and the bootstrap consensus.

trnL-F-The tmL-F region ranges in size from 1287 bases (Grammatophyllum) to 813 bases (Stellilabium). The aligned tmL-F matrix consists of 1431 bases; five regions (totaling 149 bases) were judged unalignable and excluded from the analyses (regions shown in Fig. 1). The aligned tmL-F matrix contains -957 bases of intron, the 3' exon (50 bases), and 528 bases of the intergenic spacer (Fig. 1). Numerous large indels occur in the intergenic spacer and especially the intron; some taxa (e.g., Lycomormium, Coeliopsis, Telipogon, Stelli- labium) have deletions of 300 bp or more. Of the 1282 bases included, 547 (43%) were variable, of which only 285 (22%) were potentially informative. Transversions are more numer- ous than transitions in all three regions, and the tsltv ratio is slightly higher in the exon than in the two noncoding regions (Table 4). Heuristic search (Fitch criterion) yielded more than 10000 equally parsimonious trees of 1247 steps (CI 0.58, RI 0.64).

The bootstrap consensus tree (Fig. 3) is congruent with that of matK (Fig. 2), although less resolved at the subtribal level. Zygopetalinae are not monophyletic; only the Huntleyinae clade (Dichaea to Pescatorea) and the Zygopetalum clade (Zygopetalum to Batemannia) receive weak bootstrap support.

TABLE3. Number of steps, consistency index (CI), and retention index (RI) for each codon position in mntK, based upon one of the three shortest successively weighted trees from the combined analysis.

Codon position Number of steps CI RI

~~IIL-F ITS 1&2 Comblned

Oncidiinae are unsupported, again with only the core Onci- diinae receiving weak support. Stanhopeinae show the same division into three clades as in the matK bootstrap consensus tree (Braemia; Coeliopsis clade; core Stanhopeinae). Core Stanhopeinae are highly resolved at the generic level, with most nodes displaying moderate to high bootstrap support. The placement of Eriopsis is again unresolved.

ITS nrDNA-The aligned ITS nrDNA matrix consists of 141 bp of the 18s region, ITS 1 (254 bp), the 5.8s gene (163 bp), ITS 2 (276 bp), and 90 bp of the 26s region. One region of 16 bases in ITS 1 was judged unalignable and was exclud- ed. As expected, the number of stepslsite are higher in ITS than in the coding regions (Fig. 1; Table 2). Of the 910 in- cluded positions, 630 (69%) were variable, of which 450 (49%) were potentially informative. The transitionltransver- sion ratio in the 5.8s gene and fragments of the 18s-26s nrDNA is higher than in the spacer regions, as expected for coding regions (Table 4). Heuristic search (Fitch criterion) yielded 4100 equally parsimonious trees of 2651 steps (CI 0.41, RI 0.61).

The ITS bootstrap consensus tree (Fig. 4) is highly congru- ent with the two plastid data sets (Figs. 2, 3). Eriopsis is weak- ly supported as sister to all other genera of Maxillarieae. Zyg- opetalinae (including C~ptarrhena) are weakly supported, with high support for several clades within the subtribe. Stan- hopeinae are weakly monophyletic, again consisting of a Coe- liopsis clade and a core Stanhopeinae including Braemia. Many clades within core Stanhopeinae are highly supported. Maxillariinae (sensu lato) are unsupported, but Maxillariinae (sensu stricto), Bifrenariinae (minus Rudoljiella), Lycastinae, and Xylobium show weak to high levels of support. Oncidiinae are not monophyletic; a weakly supported clade unites the core Oncidiinae with Telipogon, Stellilabium, Ornithocephalus, and Fernandezia. However, all of these deeper nodes are only weakly supported (none higher than 63% bootstrap support).

Combined analysis-Comparison of bootstrap consensus trees for equally weighted analyses of the three individual data sets revealed no hard incongruence, i.e., clades that are highly supported in one analysis that conflict with different and high-

December 20001 WHITTENET AL.-PHYLOGENETICSOF MAXILLARIEAE 1847 TABLE4. Number of steps, CI, and RI for transitions and transversions for each region based upon one of the three shortest successively weighted trees from the combined analysis. inarK 18s + 5 8S + 26s (codlng) ITS 1 ITS 2

tS t\' tS

Number of steps 46 1 697 336 CI 0.45 0.63 0.66 RI 0.62 0.74 0.20 ts:tv 0.66 2.88

trnL intron

ts tv

Number of steps 252 451 CI 0.53 0.69 RI 0.60 0.74 ts:tv 0.56

ly supported clades in the others. We conclude that differences in tree topologies are due to sampling error (Huelsenbeck, Bull, and Cunningham, 1996) resulting from three finite data sets, and not from conflicting phylogenetic signals among data sets. We therefore performed a combined analysis of all three data sets.

The combined matrix under the Fitch criterion yielded 1024 trees of 5096 steps (CI 0.48, RI 0.62). Successive weighting produced three trees of 1575 steps (CI 0.79, RI 0.83), corre- sponding to a Fitch length of 5097 (one step longer than the equally weighted trees). One of these three trees is shown in Figs. 5 and 6; the number of Fitch steps is shown above each

185 rTS 1 58s ITS 2 26 S

a I

I I I

ITS nrDNA

-
lntron    Exon    Inlergenic spacer
I = 1        I        1
Yte

Fig. 1. Number of steps per site, based on one of the successively weight- ed trees from the combined analysis, for rnatK, ITS nrDNA, and trnL-F. Regions excluded from the analysis are indicated by gray bars below the x-axis.

tY        tS    t\'        tS        t\,
116        704    378        75 1        37 1
0.44        0.44    0.32        0.44        0.24
0.78        0.63    0.61        0.65        0.55
1.86            2.02    
trrzL exo    n        tmL-F intergenic spacer        
ts        tv        ts            tv
23        28        210            322
0.32        0.50        0.46            0.66
0.54        0.32        0.55            0.61
0.82                0.65        
branch, and the Fitch and SW bootstrap values are shown be- low. An arrowhead in Fig. 6 indicates a single node that col- lapses in the strict consensus of the three shortest trees. The bootstrap analysis of the combined data set yielded higher lev- els of support (54 clades with Fitch bootstrap support >85%; Table 2) than did any of the single data sets.

In the combined analysis, Maxillarieae are highly supported as monophyletic relative to the four outgroup taxa. Eriopsis is weakly supported as sister to all other Maxillarieae. Oncidiinae are strongly supported as monophyletic, and nearly all clades within it are highly supported. In our limited sampling of On- cidiinae, this subtribe consists of a paraphyletic grade of taxa, many of which have received formal or informal recognition by orchid taxonomists. These taxa include a basal Trichopilial Psychopsis clade, a CuitlauzinalOncidium ampliatum clade, a "rat-tail" and "mule ear" clade (Oncidium cebolletalTricho- centrum), and Lockhartia. Sister to this paraphyletic grade are:

(1) a clade consisting of Pachyphyllinae (Fernandezia) sister to Ornithocephalinae plus Telipogoninae; and (2) a "core" Oncidiinae (Oncidium ornithorrhynchum, Cyrtochilum, Mil- tonia, Brassia, and others).

The remaining subtribes form a weaklylmoderately supported clade (54% Fitch; SW 87% bootstrap) that is sister to Oncidi- inaefiopsidinae. Zygopetalinae are sister to a broad Maxillar- iinae plus (Coeliopsidinae plus Stanhopeinae). The highly sup- ported (100%) Zygopetalinae lack support at several deeper nodes withn the clade, but Dichaea is clearly sister to the Pes- catorealChaubardia clade. Cryptarrhena is embedded within Zygopetalinae, but its relationships within the subtribe are poor- ly supported. Maxillariinae (as defined here) are strongly sup- ported in the SW bootstrap analysis and contain several strongly supported clades that have been recognized as subtribes by var- ious authors: Lycastinae (Lycaste, Anguloa, Neomoorea); Max- illariinae (sensu stricto) (Maxillaria, Trigonidium, Cryptocen- trum); Bifrenariinae (Bifrenaria, Rudoljiella, Scuticaria); and Xylobium. Three genera (Coeliopsis, Lycomonnium, Peristeria) form a highly supported clade sister to the remaining genera of Stanhopeinae. Clades within Stanhopeinae are highly resolved, with high bootstrap support for most nodes.

DISCUSSION

Molecular evolution-Several attributes of matK indicate that it might be a pseudogene in these orchids (and perhaps other angiosperms). The excess of transversions and the only slight excess of substitutions at third codon positions are both

matK

100 uicnaea muncata

62 I Dlcnaea negieda

91 che~bd,d,enetemhla Chandmmyncna micnenb Pescatoma lehmannii

93

wama wariesna

79 I Zygoptaium mackafl ~&ien~tein,dah,ssimd

I

BBNmannla milsy! cniO,aotiena !"nab Sculmne hadwsnli 78 64 I Rmmeila saxim1a rnn . Rihnana mdon

Coeliopsidinae

I

Slanhopa emmofa 62 slanhops DYM~ I Slanhopea notisla Slanhopea samela Slanhopa lignna

55 74

Slanhopes wardif

I 81

Slanhopa anfmda

Stanhopeinae

Oncidiinae

Eriopsidinae

Outgroups

Fig. 2. Bootstrap consensus tree from analysis of nmtK data set (Fitch parsimony). Bootstrap percentages >50% are listed above each branch.

compatible with a loss of function. Studies of dicot taxa with variable sites in both regions are evolving at similar rates (2.2 matK have noted tsltv ratios greater than 1.0 (much higher stepslsite vs. 2.3 stepslsite, respectively). Numbers of phylo- than the 0.66 found here) and also a relatively even distribu- genetically informative sites are similar, although matK is lon- tion of substitutions across codon positions (Steele and Vil- ger than trnL-F in each species. Performance, as measured by galys, 1994; Johnson and Soltis, 1994; Xiang, Soltis, and Sol- RI, is almost identical. Frequency of ts and tv is not related tis, 1998). In the large angiosperm data sets for rbcL and atpB to performance (RI) in any of these regions. All three codon (Savolainen et al., in press), the tsltv ratios are 1.6 and 1.8, positions perform similarly, but third positions are not better

respectively, and 70% of substitutions are at third positions. as reported for rbcL and atpB (Savolainen et al., in press). The tsltv ratios show no clear correlations of frequency with RI;

These statistics contrast with the low tsltv ratio and even num-

therefore, there seems to be no basis for whole-category bers of substitutions at all codon sites found in Maxillarieae.

weights. Thus, we favor SW that weights each position indi- Although the matK indels occur in triplets consistent with a vidually based upon RC.

coding region, this might indicate either a recent loss of func- tion or that patterns of indel activity continue for sbme time Classification of Maxillarieae based upon molecular after function has been lost. data-The high level of congruence anlong the three data sets,

The trnL-F region has more variable sites than matK, but representing coding and noncoding as well as plastid and nu-

mane

,,aca late

Oncidiinae

Tnchopilm mdcuiafs

Onadium ampi,a1um

Cudlaunnd perdula

Enop~smbmbuibonPen Enooss rvli&buiban Ewa

Eriopsidinae

Euiophragulmnsrr Drersiena drleda

Cyrfopodlum pumfalum IOutgroups

Giammstophylium s~iasum

Fig. 3. Bootstrap consensus tree from analysis of tmL-F data set (Fitch parsimony). Bootstrap percentages >50% are listed above each branch.

clear regions, and the high bootstrap values in the combined analysis support the resulting tree as a good hypothesis of phylogenetic relationships among the taxa sampled. To trans- late this tree into a subtribal classification, we used several criteria (Backlund and Bremer, 1998): (1) subtribes and clades must be monophyletic and highly supported; (2) nodes defin- ing subtribes preferably should include morphological syna- pomorphies that permit recognition of members; and (3) the classification should be as consistent as possible with previous systems. We did not consider levels of sequence divergence to be a primary criterion (although it is clear that patterns of bootstrap support and branch lengths are highly correlated), because these and other data indicate that some clades within the Oncidiinae (e.g., Ornithocephalus, Telipogon, and Stelli- labium) have accelerated rates of sequence divergence, per-

haps due to rapid life cycles and altered life history strategies. Based upon these criteria, we recognize the following sub- tribes within Maxillarieae:

Eriopsidinae-Dressler (1993) left this small enigmatic ge- nus as incertae sedis and suggested that it might warrant place- ment in its own subtribe. He also noted that it has Maxillaria- type seeds, so a placement within Maxillarieae seemed likely. Szlachetko (1995) created the monogeneric subtribe Eriopsi- dinae within his Maxillarieae. In a morphology-based clado- gram of relationships of Maxillarieae and Zygopetalinae, Szlachetko (1995) placed Eriopsidinae sister to Maxillariinae based on synapomorphies of duplicate leaves and entire te- gulae. Our observations of living plants indicate that leaves of Eriopsis are revolute, not duplicate. In the rbcL trees (Cam-

ITS nrDNA

DlChsas mnasis

Dch-mgl& Cheubardra helemc1,Is

Chondiahynche rsimenb

kelam lehmnn,,

Zygopetalinae

w-wslresna

ZygDpetslum mechey, Batmnnls colbyr C,ypla"kna lunsla

KoeihOlen,a e0,ssrm

Scul!mie hadwenil

Maxillariinae

I

ICoeliopsidinae I

Stanhopeinae

Lochhms arsledi

Miltone iegmllii

Ads euisnliem

M-pindlom pensmenre

Bierre g,mvdiens emagn.wCYmera Oncidiinae

,

c,echvs"fe dssysndra Cyitoch<l"msnnom Oncdiomaniharhmom 1W Oncd,"m mbalble Tiehhzenmrmplev,, Psyohoprir ppiHo

59

Tirch;lpl* ~lSlS

Oncdlom emplalom

CuiUsuzmspduls

98 ~iiqsi~

mt~dobuibonpan

Ew3!sr&,&buiaMEcua Erio~sidinae

aesslerte dliRta

C~~pod,"mp""clar"m

Grsmmlophyllvm IOutgroups

Evbphie gumssnrr

Fig. 4. Bootstrap consensus tree from analysis of ITS nrDNA data set (Fitch parsimony). Bootstrap percentages >50% are listed above each branch

eron et al., 1999), Eriopsis is nested within Maxillarieae but without strong bootstrap support. Our molecular data indicate that Eriopsis is isolated and sister to all other Maxillarieae in the shortest trees, although with weak bootstrap support. Its isolated position and lack of clear affinities support subtribal status. Further study is needed to find morphological characters that define this subtribe. The flowers, pollinaria, and seeds of Eriopsis possess no unique characters that separate them from the diversity within other subtribes, but the combination of characters exhibited fits well with Maxillarieae. To a field botanist, Eriopsis is immediately recognizable by a peculiar warty texture of the pseudobulbs and distinctive leathery leaf texture, but these traits are difficult to define as character states. This genus is rare in cultivation, and we were unable to obtain living material of other species to include in the analysis. We have no reason to suspect that the genus is not monophyletic, and inclusion of more species in the analysis is unlikely to change its subtribal placement.

Oncidiinae sensu Whitten et a1.-In previous classifications, the subtribes Ornithocephalinae and Telipogoninae have sometimes been regarded as allied to Oncidiinae but separated on the basis of pollinium number (two in Oncidiinae vs. four in the others). Earlier classifications of Orchidaceae have placed great weight upon pollinium number, with the assumption that reduction in pollinium number is largely irreversible. Our mo

Maxillarieae

Chaubardla hetemcBta Chondmitlyncharelchenb

Zygopetaiinae

Wama warreana

Zygopetalum mackayi

Cryptanhenalunata

Maxillariinae

9118

Neomoorea walllsil

CoeBopsis hyacinthosmaLycomorml~mflskel

Caeliopsidinae

Stanhopeinae

Fernandelmionanthem Orn!thocephalu~lnnexus Stellilab!~mpogonostak TelipogonpawoloMiltonia regnelliAda awantiaca Mesosp!n!diwnpsnamense Brassis gmoodianBrassia arcuigem Cfschweinlia dasyandrCyrlochilumannolare Oocldium omlthonhynchum Lockhadia ocrstedi Oncidwm cebolleta Tnchocentm pievilOncidium amplletumCuitlauzinapendula Psychopslspapla

Tnchopdiemaculata Enopsis ~t!dobulbonPan EIIOPSISrutidobolbon Ecua Dressisriadilecta Cydopod,umpunctatumGrammatophyllum speclosu Eubphie gulneensis

Fig. 5. One of three equally parsimonious successively weighted trees from the combined rrtrrtKltrrzL-FIITS nrDNA data set. Values above each branch are Fitch lengths (ACCTRAN optimization); those below branches are bootstrap percentages >50% (equally weightedlsuccessively weighted). Asterisk indicates bootstrap support <50%. The portion of the cladogram containing Stanhopeinae is shown in Fig. 6.

lecular data indicate a major reevaluation of Oncidiinae and related subtribes. Pachyphyllinae (represented by Fernandezia), Ornithocephalinae, and Telipogoninae (Telipogon, Stellilabium) form a highly supported clade that is embedded deeply within Oncidiinae. Maintaining these three clades as separate subtribes would necessitate recognition of several other segregates of the Oncidiinae at subtribal level (e.g., Trichopilia clade, CuitlauzinalPalumbina clade, Lophiaris clade, Lockhartia). A greatly expanded combined molecular analysis of the Oncidiinae (Williams, Chase, and Whitten, unpublished data) supports the inclusion of these three subtribes within a broad Oncidiinae and indicates that increases in pollinium number are possible. In all other aspects, these three subtribes are highly compatible with Oncidiinae and only pollinium number has been used to exclude them. For example, the leafy stems composed of several nodes found in Pachyphyllinae are present also in Lockhartia. The distinctive columns with elongate rostellar beaks found in Ornithocephalinae and Telipogoninae are also found in Erycina, Sigmatostalix, and some members of Oncidium section Rostrata Rolfe. The oil-secreting lip calli of Ornithocephalinae are also found in Oncidium sect. Waluewa Pabst, and the pseudocopulatory flowers of Telipogoninae are observed in Tolumnia henekenii (R. H. Schomb. ex Lindl.) Nir and Oncidium sect. Crispa Rchb.f. ex Pfitzer. Although many of these have to be viewed as parallelisms as a result of the phylogenetic patterns observed here, these tendencies are rare outside Oncidiinae and the flower structure of these groups is generally typical of Oncidiinae.

Slanhopea annuiata Stanhopea ecomuta 1001 58159 Stanhopea puiia

+?!E

100 crrhata

ward

Stanhopea rucken
Slanhopea anfracta
Stanhopea saccata
36    Slanhopea lrgnn-Sievekrngra colombrana
Srevekingia hemnhusana
1001100        95186        Coryanthes macrantha
I        !!!I 8 ""    Coryanthes eiegantrum Embreea rodigasrana
Soterosanthus shepheardrr
Kegeliella atmpiiosa
Kegelielia kuppen
Poiycycnis gratiosa

16

Lueddemannia pescatorei

1001 loo Vasquezrelia bolrviana

Lacaena spectabills

10 Honchra dresslen

-

.. Trevona zahibrucknenana

Schlimmia sp.

Schiimmia sfevensonii 65/92 Houlieba wallisir

Houlletia sanderi Houliefia figrina

1001

100

IPaphinia neudecken

Cirhaea dependens

Gongora gratuiabunda

Gongora sphaenca

26

Gongora ilense

1001

looGongora ampamana

Gongora tridentata

-25

loo/ Gongora anenraca loo Gongom escobanana

Gongora porlentosa

Braemia vittata

Fig. 6. Stanhopeinae portion of one of three equally parsimonious successively weighted trees from the combined mntK1tnzL-FIITS nrDNA data set. Values above each branch are Fitch lengths (ACCTRAN optimization); those below branches are bootstrap percentages >50% (equally weighted1 SW). Asterisk indicates bootstrap support <50%; arrowhead indicates the single branch not present in all three successively weighted trees.

Zygopetalinae-The highly supported Zygopetalinae include two anomalous genera: Dichaea and Cryptarrhena. Dichaea flower and pollinarium structure are consistent with other Zygopetalinae, but its unusual vegetative habit (long, pseudobulbless, monopodial stems and wartylspiny capsules) make it appear out of place in Zygopetalinae. The molecular analysis places Dichaea sister to the mostly pseudobulbless Huntleyinae clade (Chaubardia, Chondrorhyncha, and Pescatorea in Fig. 5). Cryptarrhena is a small genus of perhaps only four species, and the presence of pseudobulbs varies among species. The numerous, small flowers are borne on an arching raceme; the lip is clawed and anchor-shaped, and the column has a hooded, toothed clinandrium. The pollinarium lacks a conspicuous stipe and has a pair of long, hyaline caudicles and four flattened pollinia. This combination of characters led Dressler to place it in a monotypic subtribe (Dressler, 1971) and then tribe (Dressler, 1980). Our results show it firmly embedded within Zygopetalinae, and thus it does not warrant sub-tribal status. This placement was also supported by rbcL data (Cameron et al., 1999). Although the hyaline caudicles are apparently autapomorphic for the genus, the other character states might represent synapomorphies shared with other Zygopetalinae, e.g., the toothed clinandrium present in Huntleya that generic boundaries need to be reevaluated within this spe- and the anchor-shaped lip present in Dichaea. cies-rich group.

Previous classifications divide Zv~o~etalinae s. 1. into sev-

eral groups, recognized either for&il& as separate subtribes (Huntleyinae, Zygopetalinae, Warreinae, Dichaeinae; Szlach- etko, 1995) or as informal clades (Dressler, 1993). Although our generic sampling in the combined data set is far from complete, several of these clades are recognizable: Huntleyi- nae (mostly pseudobulbless, leaves duplicate); Zygopetalinae (pseudobulbed, leaves usually convolute); and the Warrea clade (pseudobulbs of several internodes, leaves plicate), plus Dichaea and Cryptarrhena. Based on the low sequence diver- gence among these clades and the high bootstrap support for the larger clade, we favor recognition of a broad Zygopetalinae (similar to Dressier's). Unfortunately, the vegetative and floral diversity makes identification of synapomorphies defining Zygopetalinae s. 1, difficult. Perhaps the most obvious syna- pomorphies for this subtribe are the usual combination of four flattened, superposed pollinia and a transverse slit-like stigma.

Dressler (1993) included Vargasiella in Zygopetalinae, but stated that it might be placed in its own subtribe; Romero and Carnevali (1993) validated the subtribe Vargasiellinae, which was also recognized by Szlachetko (1995). We were unable to obtain extractable material of this genus for inclusion in this study.

Maxillariinae-A bootstrap supported clade (Fitch 67%; SW 88%) includes Maxillariinae, Lycastinae, Bifrenariinae, and Xylobium. Most of the genera within this clade possess a distinct column foot and mentum, four rounded or ovoid pol- linia, and a broad, open stigma, but their habits vary greatly. Maxillariinae s. s. are distinguished by conduplicate leaves and usually a crescent-shaped viscidium, whereas Lycastinae have plicate leaves and strap-like viscidia. Bifrenariinae have plicate or conduplicate leaves and often have a forked stipe. Although these four clades are individually all highly supported, there is no strong support for the position of Xylobium relative to Maxillariinae s. s. and Lycastinae. Recognition of three sub- tribes in this group would therefore necessitate creation of a separate subtribe & leave Xylobium as incertae sedis. We favor lumping these clades into a single more broadly defined Max- illariinae to reflect the close relationship among these clades and to avoid creation of a monogeneric subtribe.

Dressler (1993) included Scuticaria in Zygopetalinae whereas Brieger, Maatsch, and Senghas (1993) and Szlachetko (1995) placed it in Maxillariinae s. s., but our molecular data place this genus within the Bijrenaria clade (100% bootstrap support). Although its terete, whip-like leaves are anomalous, the flowers and pollinaria of some Scuticaria species are sim- ilar to those of Rudolfiella, and the few-flowered inflorescence is a synapomorphy shared with Bijrenaria. Although more in- tensive sampling of this subtribe might improve resolution, this clade is marked by low levels of sequence divergence (relative to other subtribes, e.g., Oncidiinae). Sequencing of additional regions will be necessary to resolve relationships within these clades.

This subtribe includes the large and vegetatively diverse ge- nus Maxillaria for which estimates range from -450 to 600 species (J. Atwood and E. Christenson, personal communica- tion). Our sampling of only two placeholder species indicates that the genus is polyphyletic, and more extensive sampling with ITS nrDNA (Whitten et al., unpublished data) indicates

Coeliopsidinae sensu Whitten et a1.-These genera (Coe- liopsis/Lycomormium/Peristeria)usually have been placed in Stanhopeinae, but they are distinguished from Stanhopeinae by: (1) smooth, unribbed, ovoid pseudobulbs bearing 3-4 large, thin, plicate leaves; (2) thick inflorescence rachis bearing globose flowers with thick, fleshy sepals and petals; (3) presence of a column foot and mentum; (4) roots with prominent root hairs; and (5) most distinctively, viscidia that are button- like and sclerified with short stipes. All three genera possess elongated but typical Maxillaria-type dust seeds (Whitten, un- published data), not Stanhopea-type balloon seeds. Like Stan- hopeinae, members of this subtribe are all pollinated by fra- grance-collecting male euglossine bees. The button or tab-like viscidia of this clade are adapted to attachment on the smooth surface of the scutum of male bees (in Peristeria elata, the vertex of the bee's head; in Coeliopsis, on the frons of the bee's head; Williams, 1982). The viscidia are reminiscent of those of some Oncidiinae, and it is unclear whether this rep- resents a symplesiomorphy or (more likely) is a convergent adaptation for attachment to smooth surfaces of the pollinator. In all species of this clade observed in the greenhouse, the unpollinated flowers do not abscise from the inflorescence as they senesce. The flowers wither on the rachis, and the entire dried inflorescence remains attached to the plant for weeks or months in the greenhouse. To our knowledge, this trait is unique within Maxillarieae.

Szlachetko (1995) split Stanhopeinae into two subtribes, creating Coeliopsidinae to accommodate Coeliopsis, Lacaena, Lueddemannia, Lycomormium, and Peristeria. In the errata ac- companying his text, he excludes Lacaena from his concept of Coeliopsidinae; however, he does not explicitly place it within Stanhopeinae. Lacaena and Lueddemannia have polli- naria typical of other Stanhopeinae, lack a distinct column foot, and have a floral abscission layer; on the basis of mor- phology and molecular data, they clearly belong in Stanho- peinae and not in Coeliopsidinae.

Stanhopeinae sensu stricto-In the remaining genera of Stanhopeinae s, s., viscidia and stipes are thin and strap-like and adapted for attachment to the edge of the bee's scutellum or to a leg. The pseudobulbs are usually either ribbedlfour- angled or flattened, and leaf texture is often thicker than in Coeliopsidinae. Roots are smooth, without prominent root hairs, and a column foot is lacking or indistinct. Unpollinated flowers quickly abscise and fall from the inflorescence. Al- though most members of Stanhopeinae possess highly distinc- tive balloon seeds (see Dressler, 1993, for example), this char- acter apparently shows several reversals to the typical Maxil- laria dust-type seeds (in the Acineta clade and in several clades within Gongora; Whitten, unpublished data). Because of these differences, we favor recognition of separate Coeliop- sidinae and Stanhopeinae. Although both clades are highly supported sister taxa, lumping them into a broader Stanhopei- nae creates a subtribe that is difficult to define by morpholog- ical synapomorphies. Splitting them into separate subtribes al- lows Stanhopeinae (s, s.) to be characterized by pollinaria with ligulate or triangular viscidia, distinct stipes, two flattened pol- linia, no column foot, a floral abscission layer, and (usually) balloon seeds.

Clades within Stanhopeinae (Fig. 6)-Braemia-Jenny (1985) created the monotypic genus Braemia to accommodate the anomalous Polycycizis vittata (Lindl.) Rchb.f., citing dif- ferences in several vegetative and floral characters (e.g., lack of trichomes on rachis and lip) that distinguish it from mem- bers of Polycycnis. Our results support this transfer and affirm its generic uniqueness. We sequenced two different accessions of Braemia to verify its position in the trees; sequences were identical. The morphology of its column and pollinaria are typical of most Stanhopeinae, and its lip shape is somewhat similar to that of Polycycnis and Kegeliella, but the molecular results indicate that it is auite isolated within the subtribe and has no clear affinities with any other clade. Like most genera of Stanhopeinae, it possesses balloon seeds, although they are unique in being pointed at both ends (Whitten, unpublished data). No pollination data exist for Braemia, but floral/polli- narium morphology indicates that the pollinarium is probably deposited on the bee's scutellum.

Gongora clade (Cirrhaeu/Gongora)-These taxa produce moderately to strongly ribbed pseudobulbs with one or two thin leaves. The inflorescence is pendent, many-flowered, thin, and wiry. The lip is fleshy and complexly three-parted. The lip is uppermost in both genera, but they have different pol- lination mechanisms. In Cirrhaea, the column curves upward, and the viscidium is hook-shaped; the pollinaria are attached to the base of the bee's leg. In Goizgora, the bee hangs upside down from the lip and slides past the end of the column when exiting, guided by the adnate petals; pollinaria are attached to the scutellum. Jenny (1993) recognized several subgeneralsec- tions of Gongora, and these subgeneric taxa are recognizable in the combined cladogram (Fig. 6). Relationships within Gon- gora will be examined in detail in a subsequent paper. Cir- rhaea and Gongora subgenus Portentosa (the sister clade of the rest of Gongora) share a character not found in any other Stanhopeinae; the ovary and pedicel are complexly twisted so that the flowers face outwards from the rachis of the inflores- cence. In the remaining species of Gongora, the twist is absent and the flowers face inwards towards the rachis.

Acineta clade (Acineta/Lacaena/LueddemanniaNasqueziella)-These taxa are distinguished by flattened, slightly ribbed pseudobulbs bearing 3-4 leaves, pendent inflorescences with many fleshy flowers, and complex lips with large lateral lobes. Pollinarium structure varies within Acineta; in most species, the viscidium is rectangular with a 45' crease that allows it to fit onto the underside of the bee's scutellum where it joins the posterior thorax. In at least one species (Acineta deizsa Lindl.), the viscidiurn and stipe are narrow and typical of most Stan- hopeinae, indicating that it might attach to the edge of the scutellum or perhaps back of the head. The monotypic Boli- vian Vasqueziella is strongly supported as sister to Acineta and perhaps should be included within Acineta.

Polycycnis clade (Kegeliella/Polycycnis/Soterosanthus)Plants of this clade vary in size from <10 cm to nearly 1 m and produce one or two thin leaves per pseudobulb. Some species produce a reddish anthocyanin pigmentation on the underside of the leaves, a character not found in other Stan- hopeinae. Most distinctively, the many-flowered inflorescence has persistent black or brown trichomes. The column apex has broad wings, and the pollinaria are small and delicate. Jenny (1986) created the monotypic Soterosanthus to accommodate Sievekingia shepheardii Rolfe; it does not agree with the veg- etative and floral characters of Sievekingia. Our analyses sup- port his conclusions and place Soterosanthus sister to Kege- liella. The lips of Kegeliella and Polycycnis are three-parted, with broad hypochilar wings and a deltoid to ligulate epichile,

and their flowers are resupinate. Pollinaria are deposited on the bee's scutellum in Polycycizis and on the back of the head in Kegeliella. Flowers of Soterosanthus are nonresupinate, the lip is simple and entire, and the viscidium is curved; these are adaptations to pollinarium placement on the leg of the polli- nator. Gerlach (1999) examined a Euglossa crassipuizctata Moure bearing pollinaria of both Soterosanthus and an un- identified Sievekingia. Pollinaria of both species were attached to the trochanter of the middle or hind legs, but the pollinaria of Soterosaizthus are borne on a long, stiff stipe that projects outward from the bee's body, whereas the stipes of Sievekingia are shorter and twist inward under the bee's body. These dif- ferences indicate that subtle mechanical isolating mechanisms might exist even among orchids that utilize the same pollinator and site of pollinarium attachment.

The molecular data also indicate paraphyly of Polycycnis; the two species with a ligulate epichile and two leaves per pseudobulb (P. orizata arid P. aurita) are sister to Kegeliellal Soterosanthus, not to the other species of Polycycizis with a deltoid epichile and mostly one leaf per pseudobulb (P. gratiosa). More sampling within the genus (especially P. annectans Dressler, P. tortuosa Dressler, and P. breviloba Summer- hayes) is needed to clarify generic relationsfips. Recently, Jen- ny (1999) transferred P. breviloba to a new monotypic genus, Luekelia Jenny, which has priority over Brasilocycnis Gerlach and Whitten (Gerlach and Whitten, 1999). Living material of this species was not available for inclusion in the combined analysis, although preliminary ITS data affirm its distinctive- ness from the rest of Polycycizis.

Stanhopea clade (Coryanthes/Embreea/Stanhopea/Sievekingia)-This clade includes the greatest diversity of floral mor- phologies and pollination mechanisms within the subtribe. Coryaizthes flowers are complex in form and function; the large, fleshy lip forms a bucket trap that is filled with a watery fluid produced by a pair of "faucet" glands on the base of the column. Bees are lured to osmophores on the hypochile and fall into the bucket during fragrance collection; the pollinarium is deposited between the thorax and abdomen as the bee crawls out through an exit formed by the tip of the lip and the column. In contrast, the flowers of Sievekingia are nonresupinate and simple; the thin, cupped lip bears only a toothed callus, and the lip margin may be entire or highly finlbriate. The polli- narium has a curved viscidium and is attached to the trochanter of the bee's leg (Gerlach, 1999). In spite of the great morpho- logical differences, these two genera are sister taxa with high bootstrap support in our analyses. If this relationship is correct, we suggest that the intermediate forms leading to the ev~lution of Coryanthes are either extinct or never existed (i.e., Cor- yanthes is the result of a swift and massive reorganization of floral morphology), leaving us with few clues as to how the complex floral mechanism of Coryanthes evolved. The flowers of Staizhopea are also large, Aeshy, and have a usually three- parted lip with a deeply saccate hypochile that encloses the osmophore tissue. One might hypothesize that the bucket of Coryanthes evolved by enlargement of the saccate hypochile of something like Stanhopea. However, artificial hybrids be- tween Stanhopea and Coryanthes clearly indicate that the bucket of Coryanthes is entirely derived from the epichile, not the hypochile (Whitten, personal observation).

Staizhopea can be divided into several monophyletic groups on the basis of lip shape and number of flowers per inflores- cence. The "two-flowered" species of Staizhopea (e.g., S. an- nulata, S. pulla) possess more or less entire lips and operate as simple gullet flowers; the pollinarium is deposited on the bee's scutellum as the bee backs out of the flower. The mul- tiflowered species of Stanhopea (e.g., S. wardii) have fall- through flowers with three-parted lips; the bee slips while backing out of the waxy hypochile and falls through a channel formed by the mesochile, epichile, and the column. A third clade (not represented in this analysis) is formed by the Am- azonian species such as S. candida Barb. Rodr. and S. graiz- dijora (Bonpl.) Rchb.f. The molecular data indicate that the genus is monophyletic in spite of these differences in mor- phology and pollination systems. The monotypic Embreea was created by Dodson (1980) to accommodate Stanhopea rodi- gasiana Claes ex Cogn., which has numerous autapomorphies that separate it from the rest of Stanhopea species. The mo- lecular data confirm its distinctiveness; it is unsupported as sister to any other genus in this clade. Although we have no pollination data on Embreea, its morphological similarity to Stanhopea indicates that it also has a fall-through flower.

Houlletia clade (Horichia/Houlletia/Paphinia/Schlimmia/ Trevoria) clade-Although well su~~orted.

this clade lacks obvious korphological synapomorphies. ~ost members have a lip clearly divided into several parts, with a broad, triangular epichile and a hypochile with acute, curved lateral projections. Resupination of flowers varies among and within genera. The flowers of Schlimmia and Trevoria are nonresupinate and the pollinaria are deposited on the base of the bee's legs. The fleshy lateral sepals are partly (Trevoria) or completely (Schlimmia) fused to form a saccate cavity that encloses the lip and guides the pollinator. The lip is greatly reduced and vestigial in Schlimmia. Trevoria is distinguished by an asym- metric twist of the column (G. Gerlach, personal communi- cation), similar to that of Mormodes (Catasetinae); the func- tional significance of this twist is unknown. Most species of Paphinia have resupinate flowers and deposit pollinaria on the rear edge of the scutellum, except for the nonresupinate P. subclausa Dressler that attaches pollinaria to the bee's leg (Dressler. 1968). The monotv~ic Horichia is clearlv distinct

u L L

2 1

from the other genera of this clade on the basis of both mor- phology and molecular data. Its lip consists of a small, hemi- spherical hypochile bearing a pair of acute horns plus a nar- row, acute epichile.

In the combined tree (Fig. 6), Houlletia is not monophyletic; the H. sanderi clade is sister to SchlimmialTrevoria (which also have nonresupinate flowers and leg pollination). Houlletia tigrina is sister to all other members of this clade. Sampling of additional species is needed to evaluate the apparent para- phyly of Houlletia. As presently defined, Houlletia consists of two morphologically distinct groups. The group containing H. brockelhurstiana (the type species), H. tigrina, H. odoratissi- ma Linden ex Lindl. and HI juruenensis Hoehne have open, resupinate flowers that are heavily spotted in red-brown. The epichile is triangular and the hypochile bears a pair of curved, acute projections; the lip shares many features of the lip of Paphinia. The viscidium is narrow, approximately the same width of the long stipe, and the pollinaria are deposited on the bee's scutellum. In contrast, the group containing H. sanderi, H. wallisii, H. clarae Schltr., and H. lowiana Rchb.f. has glo- bose, nonresupinate flowers that are white to yellow, mostly unspotted, and borne on an erect inflorescence. The epichile is rectangular or ovate (not triangular), and the lateral projec- tions on the hv~ochile are broad instead of acute. The ~olli-

,L

narium has a broad, concave viscidium. Pollination has not been observed, but the nonresupinate flowers and viscidium shape indicate that the pollinaria might be deposited on the bee's leg.

Recently, Lueckel, and Fessel (1999) created the genus Jeiznyella to accommodate the globose, white flowered taxa (H. sanderi, H. kalbreyeriana Kraenzl., H, clarae Schltr.), but ex- cluding H. wallisii and H. roraimensis Rolfe. Additional sam- pling and careful morphological analyses are needed to eval- uate rnonophyly and generic boundaries within and among Houlletia, Trevoria, and Schlimmia.

Archivea kewensis Christenson & Jenny-The type and only specimen of this monotypic genus is a watercolor by T. Dun- canson in the herbarium archives of the Royal Botanic Gar- dens, Kew; no pressed or living material is known (Christen- son and Jenny, 1996). Consequently, we were unable to in- clude it in our analyses and its relationships remain uncertain.

General conclusions-As noted by previous workers (Chase and Cox, 1998; Graybeal, 1998), the greater taxon sampling appears to increase levels of bootstrap support and resolution. In the bootstrap consensus trees of the three sepa- rate analyses, Stanhopeinae (densely sampled) were consistently well resolved and supported, whereas the other subtribes (sparsely sampled) were less resolved. Likewise, the combined analysis yielded fewer shortest trees and higher levels of sup- port than any of the separate analyses.

Generic limits within Stanhopeinae generally are well sup- ported by the DNA data, in contrast to Oncidiinae (Chase and Palmer, 1988, 1997) and several other subtribes (Zygopetali- nae, Maxillariinae: Williams, Whitten, and Chase, unpublished data). Floral morphology of Stanhopeinae and Coeliopsidinae is complex and adapted for relatively precise placement of pollinaria on the body of male euglossine bees. The diversity of sites on the bee's body used by different genera is a form of mechanical isolation mechanism that reduces competition for pollination. This diversity of different pollination mecha- nisms and floral momholoeies ~rovided characters that earlier

u 1

workers used to define genera. The molecular data generally support these generic concepts based on morphology.

Stanhopeinae and Coeliopsidinae provide a legitimate re- ward to pollinators in the form of floral fragrances. The ma- jority of species in other subtribes appear to be deceit-polli- nated; many Oncidiinae are mimics of oil-secreting Malphi- giaceae or are nectar-deceit mimics (e.g., Ada, Aspasia, Coch- lioda, Trichoceiztrum). The specificity and set of reward-offering morphologies make floral morphology a gen- erally good indicator of phylogenetic relationships among taxa of reward flowers (e.g., Stanhopeinae), whereas in other groups with nonspecific deceit flowers or a mixture of syn- dromes, floral morphology is highly misleading of phyloge- netic relationships. This hypothesis is supported by recent mo- lecular analyses of Catasetinae (Pridgeon and Chase, 1998), which are all pollinated by fragrance-collecting male euglos- sine bees. As in Stanhopeinae, there is excellent congruence between generic relationships based on floral morphology (Romero, 1990) and the molecular data. Zygopetalinae exhibit a mixture of pollination syndromes, with some species pro- viding a true fragrance reward to male euglossines and other species that are nectar deceit flowers (Williams, 1982; Ack- erman, 1983, 1986). There is considerable disagreement on generic concepts within the Huntleyinae clade, and prelirni- nary molecular analyses (Whitten et al., unpublished data) in- dicate that most of the confusion in generic boundaries is cen- tered around taxa that are nectar deceit flowers.

The real importance of DNA patterns is not just in clarifying generic limits, but rather as the foundation for examination of evolutionary effects of life history traits (e.g., pollination bi- ology, ecology, vegetative habit), as well as specific morpho- logical characters (seed and pollinarium morphology, anato- my). A robust phylogeny is critical to an understanding of the diversity of form observed in this family that has been studied extensively since the time of Darwin (1877). Previous attempts to understand the evolution of orchid morphology and polli- nation systems used phylogenies constructed with characters largely based upon pollination-related traits, with attendant hazards of circularity. With the aid of DNA information, this area of research can be placed in a more robust evolutionary framework than was previously possible.

LITERATURE CITED

ACKERMAN, 1983. Euglossine bee pollination of the orchid, Cochlean-

J. D. thes lipscombiae: a food source mimic. American Journal of Botany 70: 830-834.

. 1986. Mechanisms and evolution of food-deceptive pollination sys- tems in orchids. Lindleyana 1: 08-1 13. BACKLUND,A,, AND K. BREMER. 1998. To be or not to be: Principles of classification and monotypic plant families. Tnxon 47: 391-400. BALDWIN,B. G., M. J. SANDERSON,

J. M. PORTER, M. E WOJCIECHOWSKI,

D. S. CAMPBELL, AND M. J. DONOGHUE. 1995. The ITS region of nu- clear ribosomal DNA: a valuable source of evidence on angiosperm phy- logeny. Annals of the ~Missouri Botanical Garden 82: 247-277.

BARTHLOTT,W., AND B. ZIEGLER. 1981. Mikromorphologie der Samenschal-

en als systematisches Merkmal bei Orchideen. Berichte der Deutschen

Botanischen Gesellschaft 94: 267-273. BRIEGER,E G., R. MAATSCH, AND K. SENGHAS[EDS.]. 1994, 1995, 1996, 2000. In Schlechter Die Orchideen. 1713-2056. 2309-2436. Blackwell Wissenschafts-Verlag, Berlin-Wein, Germany.

BURNS-BALOGH,P., AND V. A. FUNK. 1986. A phylogenetic analysis of the

Orchidaceae. Smitlzsonian Contributions to Botany 61: 1-79.

CAMERON,K. M., M. W. CHASE, W. M. WHITTEN, P. J. KORES, D. C. JAR-

-,    AND A. V. COX. 1998. Gene sequences, collaboration and analysis
of large data sets. Australian Systematic Botany 11: 215-229.
-,    AND H. H. HILLS. 1991. Silica gel: An ideal material for field pres-
ervation of leaf samples for DNA studies. Taxon 40: 215-220.
, AND J. D. PALMER. 1988. Chloroplast DNA variation, geographical
distribution, and morphological parallelism in subtribe Oncidiinae (Or-
chidaceae). American Journal of Botany 75(6II): 163-164 (Abstract).
-,    AND -. 1997. Leapfrog radiation in floral and vegetative traits
among twig epiphytes in the orchid subtribe Oncidiinae. In T. J. Givnish
and K. J. Sytsma [eds.], Molecular evolution and adaptive radiation, 331-
352. Cambridge University Press, Cambridge, UK.
, AND J. S. PIPPIN. 1987.    Seed morphology in the Oncidiinae and
related subtribes (Orchidaceae). Systematic Botany 13: 313-323.
CHRISTENSON,E. A,, AND R. JENNY. 1996. Archivea. Orchids 65: 496-499.

Cox, A. V., A. M. PRIDGEON, V. A. ALBERT, AND M. W. CHASE. 1997. Phylogenetics of the slipper orchids (Cypripediodeae, Orchidaceae): nu- clear rDNA ITS sequences. Plant Systematics and Evolution 208: 197-

223.

DARWIN, C. 1877. The various contrivances by which orchids are fertilised by insects, 2nd. ed. D. Appleton, New York, New York, USA.

DAVIS, J. I., M. P. SIMMONS,D. W. STEVENSON,

AND J. E WENDEL. 1998. Data decisiveness, data quality, and incongruence in phylogenetic anal- ysis: an example from the monocotyledons using mitochondria1 atpA sequences. Systematic Biology 47: 282-310.

DODSON,C. H, 1980. Embreea-new genus in the Orchidaceae. Phytologia

46: 389-390.

DOUZERY,E. J. P., A. M. PRIDGEON, P. KORES, H. P. LINDER, H. KURZWEIL, AND M. W. CHASE. 1999. Molecular phylogenetics of Diseae (Orchi- daceae): a contribution from nuclear ribosomal ITS sequences. American Journal of Botany 86: 887-899.

DOYLE, J. J., AND J. S. DOYLE. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11-15. DRESSLER,R. L. 1968. Observations on orchids and euglossine bees in Pan- ama and Costa Rica. Revista Biologia Tropical 15: 143-183. . 197 1. Nomenclatural notes on the Orchidaceae-V. Phytologia 21: 440-443. . 1980. Orquideas huerfanas 11. Cryptarrhena-Una nueva tribu, Cryptarrheneae. Orquidea 7: 283-288. -. 1981. The orchids: natural history and classification. Harvard Uni- versity Press, Cambridge, Massachusetts, USA. . 1989. The vandoid orchids: a polyphyletic grade? Lindleyana 4: 89-

93. . 1993. Phylogeny and classification of the orchid family. Dioscorides Press, Portland, Oregon, USA. , AND C. H. DODSON. 1960. Classification and phylogeny in the Or- chidaceae. Annals of the Missouri Botanical Garden 47: 25-68. FARRIS, J. S. 1969. A successive approximations approach to character

weighting. Systematic Zoology 18: 274-385. FELSENSTEIN, 1985. Confidence limits on phylogenies: an approach using

J.

the bootstrap. Evolution 46: 59-173. FREUDENSTEIN, 1999. What does morphology

J. V., AND E N. RASMUSSEN. tell us about orchid relationships?-A cladistic analysis. American Jour- nal of Botany 86: 225-248.

GARAY, L. A. 1972. On the origin of the Orchidaceae, 11. Journal of the Anzold Arboretum 53: 202-215. GERLACH,G. 1999. Sievekingia and Soterosailthus: related but different. Orquideologia 21: 214-227. -, AND W. M. WHITTEN. 1999. Brasilocycnis, eine neue gattung der subtribus Stanhopeinae. Jounzalfiir den Orchideenfeund 6: 188-192. GRAYBEAL, 1998. Is it better to add taxa or characters to a difficult phy-

A.

logenetic problem? Systeinatic Biology 47: 9-17. HUELSENBECK, 1966. Combining

J. E, J. J. BULL, AND C. W. CUNNINGHAM. data in phylogenetic analysis. Trends in Ecology and Evolution 11: 152-

JENNY, R. 1985. Braemia, eine neue Gattung der Gongorinae. Orchidee 36: 36-38.

1986. Einige Notizen zur Gattung Sievekingia: Die Gattung Soter-

-. -.

osanthus und zwei neue Arten: Sievekingia herrenhusana und herklot

ziana. Orclzidee 37: 73-80.

1993. Monograph of the genus Gongora Ruiz & Pavon. Koeltz RELL, V. A. ALBERT, YUKAWA,H. G. HILLS, AND D. H. GOLDMAN.

1999. A phylogenetic analysis of the Orchidaceae: evidence from rbcL

nucleotide sequences. American Journal of Botany 86: 208-224. Scientific Books, Champaign, Illinois, USA. CHASE, M. W. 1987. Systematic implications of pollinarium morphology in 1999. Lueckelia, a new genus in the Stanhopeinae. Australian Orchid

.

Oncidiunz Sw., Odontoglossum Kunth, and allied genera (Orchidaceae).

Review 62:14-16.

Lindleyana 2: 8-28.

JOHNSON,L. A,, AND D. E. SOLTIS. 1994. inatK DNA sequences and phy- logenetic reconstruction in Saxifragaceae s. s. Systematic Botany 19: 143-156. , AND -. 1995. Phylogenetic inference in Saxifragaceae sensu stricto and Gilia (Polemoniaceae) using matK sequences. Annals of the ~Missouri Botanical Garden 82: 149-175.

KORES,P. K., K. CAMERON, M. MOLVRAY, AND M. CHASE. 1997. The phy- logenetic relationships of Orchidoideae and Spiranthoideae (Orchida- ceae) as inferred from rbcL plastid sequences. Lindleyana 12: 1-11.

LUECKEL,E., AND H. FESSEL. 1999. Jennyella, a new genus in the subtribe Stanhopeinae, with notes on the genus Houlletia. Caesiana 13: 1-8.

LLEDO, M. D., M. B. CRESPO, K. M. CAMERON, M. E FAY,AND M. W. CHASE. 1998. Systematics of Plumbaginaceae based on cladistic anal- ysis of rbcL sequence data. Systematic Botany 23: 21-29.

MADDISON,W. P., AND D. R. MADDISON. 1997. MacClade: analysis of phy- logeny and character evolution, version 3.07. Sinauer, Sunderland, Mas- sachusetts, USA.

PRIDGEON,A. M., AND M. W. CHASE. 1998. Phylogenetics of subtribe Ca- tasetinae (Orchidaceae) from nuclear and chloroplast DNA sequences. In

C. E. de Britto Pereira [ed.], Proceedings of the 15th World Orchid Con- ference. Rio de Janiero, 275-281. Naturalia Publications, Turriers, France.

ROMERO,G. A. i990. Phylogenetic relationships in subtribe Catasetinae (Or- chidaceae, Cymbidieae). Lindleyana 5: 160-1 8 1. -, AND G. CARNEVALI. 1993. Reappraisal of subtribe Vargasiellinae (Maxillarieae, Orchidaceae). Novon 3: 79. SAVOLAINEN,

V., M. W. CHASE, S. B. HOOT, C. M. MORTON, D. E. SOLTIS,

C. BAYER, M. E FAY, A. Y. DE BRUIJN, S. SULLIVAN,

AND Y.-L. QIU. 2000. Phylogenetics of flowering plants based upon a combined analysis of plastid atpB and rbcL gene sequences. Systenzatic Biology 49: 306-

362. SCHLECHTER, 1926. Das System der Orchidaceen. Notizblatt des Botan-

R.
ischen Gartens und Museums zu Berlin-Dahleln 9: 563-591.

SEELANAN,T., A. SCHNABEL, AND J. E WENDEL. 1997. Congiuence and consensus in the cotton tribe (Malvaceae). Systenlatic Botany 22: 259-

290.

SOLTIS, D. E., AND P. S. SOLTIS. 1998. Choosing an approach and an appro- priate gene f~r phylogenetic analysis. In D. E. Soltis, P. E. Soltis, and J.

J. Doyle [eds.], Molecular systematics of plants 11: DNA sequencing, 1-

42. Kluwer Academic Publishers, Boston Massachusetts, USA. --, M. E. MORT, M. W. CHASE, V. SAVOLAINEN,

S. B. HOOT, AND C. M. MORTON. 1998. Inferring complex phylogenies using par-

simony: an empirical approach using three large DNA data sets for an- giosperms. Systematic Biology 47: 32-42.

STEELE, K. P., AND R. VILGALYS. 1994. Phylogenetic analyses of Polemon- iaceae using nucleotide sequences of the plastid gene matK. Systematic Botany 19: 126-142.

SUN, Y., D. Z. SKINNER,G. H. LIANG, AND S. H. HULBERT. 1994. Phyla-genetic analysis of Sorglzunz and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89: 26-32.

SWOFFORD,D. L. 1999. PAUP:':: phylogenetic analysis using parsimony ("'and other methods), version 4.0b. Sinauer, Sunderland, Massachusetts, USA.

SZLACHETKO,D. L. 1995. Systema Orchidalium. Fraglnenta Floristica et Geobotalzica Supple~izentum 3: 1-152. TABERLET, AND J. BOUVET. 1991. Universal prim-

P., L. GIELLY, G. PAUTOU, ers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1 109.

VAN DER PIJL,L., AND C. H. DODSON. 1966. Orchid flowers: their pollination and evolution. University of Miami Press, Coral Gables, Florida, USA. WIENS,J. J. 1998. Combining data sets with different phylogenetic histories. Systematic Biology 47: 568-581.

WILLIAMS,N. H. 1982. The biology of orchids and euglossine bees. In J. Arditti [ed.], Orchid biology, 119-172. Cornell University Press, Ithaca, New York, USA.

XIANG, Q.-Y., D. E. SOLTIS,AND P. S. SOLTIS. 1998. Phylogenetic relation- ships of Cornaceae and close relatives inferred from matK and rbcL sequences. American Journal of Botany 85: 285-297.

Comments
  • Recommend Us